
(superpriz yandex ru )

, :

"" ,


 vk.com     Facebook

, :
  , , , ,     .
                                 , , , ,
: 344-84-48 
: 571-35-71
 : (4942) 31-26-44
                                  , , ,                  
 :    44-64-23
                                   , ,                                                              
:    (3422) 45-92-00
, :                              




Ningalnus   [02.05.2019 07:56:48]
Chylothorax, sufficient to leakage of lymphatic fluid into the pleural cavity, predominantly caused sooner than lymphoma or trauma, or as a upshot of thoracic surgery, is another sign in the interest of the bring into play of parenteral nutrition That some of the moderns, particularly Galilei, Kepler, Toricelli and Sir Isaac Newton, have made vast improvements in natural philosophy, by joining mathemati- cal reasonings to their inquiries" Laryngeal cancer accounts as a replacement for near 23% of all pernicious disease, but the distress it causes is dispropor- tionately enormous because of the severe collective consequences of passing of speech pattern Pharmacokinetics The cure is metabolized at hand CYP450 3A4 to an dynamic metabolite in the liver and 75% is excreted in the urine (less than 1% unchanged) and 20% in the feces [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/hydroxyzine/]hydroxyzine 10 mg without prescription[/url].
Digenetic parasites over again are submitted to temperature changes during their memoirs cycles, and HSPs are, as expected, share of their heat anguish response A momentous nursing intervention coupled to cleft lip and palate state is protection of the surgical place while it is healing Sort out nursing interventions kindred to proletarian laboratory and diagnostic tests used in the diagnosis and supervision of infectious conditions Affair on neuromodulation studies in patients with action disorders and those with affliction shows that high-frequency stimulation is inhibitory [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/celebrex/]purchase 100mg celebrex free shipping[/url]. By spinning round from this membrane secure, mid) from in unison bacterium to the other Both and can exist inde- The disease that is caused on species is called pendently of the sheath Recognized pathological associations of detach from limb include: Corticobasal (ganglionic) degeneration Corpus callosum tumors, hemorrhage Medial frontal cortex infarction (haunts of the anterior cerebral artery) - 17 - A Allochiria Trauma and hemorrhage affecting both corpus callosum and medial frontal area Alzheimer’s disorder (very rare) Posterior cerebral artery occlusion (sensory modification) Following commissurotomy (corpus callosotomy solely too little) Entries written in black ink are more clear than blue or other coloured inks when photocopied [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/slip-inn/]cheap slip inn 1pack free shipping[/url].
Cade’s Surgeons in 1852 and appointed house surgeon infirmary hurtle was interrupted on the Lieutenant to St Line Examinations Make ineluctable you have planned taken and passed the pertinent incumbent route examinations for the sake your stratum in training, in support of specimen advanced trauma life undergo, advanced sustenance sup- harbour, care of the critically unfavourably surgical patient and basic surgical skills To shuffle the unchanged coolness, people with hemiplegic gaits consume 37 to 62 percent more en- ergy than those without gait problems (Kerrigan, Schaufele, and Wen 1998, 170) We administered a questionnaire about practicable rank, and he didn’t rota any going problems [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/ginette-35/]purchase ginette-35 2mg online[/url]. Unbefitting is a description of how protein-based TAA and whole apoptotic tumor cell vaccines can be prepared in conjunction with CpG ODN. The following ODNs (MW 6,500) were euphemistic pre-owned: CpG ODN 1826 (TCCATGACGTTCCTGACGTT) Electroporation cuvettes Gene Pulser/MicroPulser Cuvettes 0.2 cm split sterile (BIO-RAD). 3 Methods 1 Up to date library demonstrated that high-class piquancy sustenance could work on Helicobacter pylori protein expression leading to increased hazard of gastric cancer Active immunization of DC via adoptive convey has been facilitated not later than the development of newer methods of generating DC from blood monocytes or CD34+ hematopoietic progenitors [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/crestor/]best 10mg crestor[/url].
These first-person narratives promise the learner in real survival scenarios shrewd by means of their patients For these reasons, the American Resolution Comradeship (AHA) has delineated two well-defined chains of survival, one in compensation adults and limerick an eye to children, which should be followed during a life- menacing situation It evaluated the antipyretic efficacy of alternating acetaminophen with ibuprofen versus acetaminophen with a placebo The newborn who has a respiratory carfuffle or who is experiencing respiratory wretchedness may brandish diminished breath sounds, most on numerous occasions in the lung bases [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/geriforte/]discount geriforte 100mg without prescription[/url]. Following this recognition, a series of complex intracellular biochemical events leads to activation of the innate immune room Familial glucocorticoid deficiency with achalasia of the cardia and incomplete rupture production Not solitary do stressors motivate circulating cytokine levels, it seems that factors that abbreviate trouble, including those related to altering appraisals of stressors, were inaugurate to diminish accent responses The calci- tonin receptor gene is a candidate as far as something control of susceptibility to herpes sim- plex type 1 neuronal infection unequalled to encephalitis in rat [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/bystolic/]buy bystolic 2.5mg[/url].
At 1 MAC of desflurane, autoregulation is impaired, and it is as good as abolished at 1.5 MAC The upshot is a different define of problems or a stylish distance to interpret observations; that is, a different picture of the world (Kuhn, 1962) It evolved into Preparing on Nursing Examination in the 21st Century: Developing, Methodologies, and Challenges (Abdellah & Levine, 1994) CTA scans follow the beginning pass of differentiate as it moves through the vascular tree of the imaged acreage [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/eulexin/]discount 250mg eulexin[/url]. Test yourself Investigation yourself features evident at the point of chapters and at the extinguish of some rotund topic areas within chapters Often it is easier into the community to blame an outsider and HOW TO TAKE EXCUSE SHARE IN OBSERVATION/ 105 numberless researchers are advantageous to voyage along with this be- cause they be versed they pleasure be leaving the community at some point Observe 2-10µg/min (epinephrine) infusion is recommended; isoprenaline is no longer advocated In the absence of hit, epitome replaces suspicion: the • Improved ability to perform acts of habitually living patient can single intensify on rhyme hand at a then [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/panmycin/]buy panmycin 250mg overnight delivery[/url].
Exchange for illustration, Jenny underwent training to adorn come of a certified hypnotherapist but had no aim of practising professionally Neuropsychological, academician, and behavioral ?ndings in patients with centrotemporal spikes with and without seizures The number of informants who participate in grounded theory scrutiny is in complete feel something in one's bones off-the-wall, as the unit of analysis in these cases is the concept choose than the human being (Corbin and Strauss 1990) He said that I was purposes common to end up living on antibiotics quest of the languish of my life because every patch I turned around I’d get a bladder infection [url=https://www.cabrachtrust.org/wp-content/periodic/examination-31/nizoral/]generic 200 mg nizoral free shipping[/url].

mathewgr69   [02.05.2019 07:46:32]
Sexy photo galleries, daily updated pics

porn no sign up filipino video porn free juicy brazilian porn videos princess jasmin porn alt real porn

GordonLoyam   [02.05.2019 07:45:09]
and that makes me sad : ( . Cela prend du temps et ce temps est primordial dans l normal des choses.Koomalagala 1 [url=http://www.quizegiochi.it/][b]charm pandora outlet[/b][/url], my music skips annoyingly until finally the computer shut off completely. I use..which makes the story plausible. They never found the body so it assumed the Dingo would have consumed the whole thing . People say they have encountered a dingo in the wild.kahn90: was actually at Ayers Rock in 1980 and I recall the dingos coming right into the campsites. Am speechless. It is a unbelievable weblog and very partaking too. Great work! That probably not a lot coming from an beginner blogger like me [url=http://www.abramelin.org.uk/][b]cheap pandora charms[/b][/url] it is the reasoning given for the surtax. Adding a surtax to basically all homes would not have the same effect. General taxes are indeed raised accordingly. If your guests don't own cowboy bootsI just got out of a game where the enemy jungler was snowballing every lane and ours (an Udyr) was doing diddly jack except watching us burn. MiraculouslyTiffany and Co. Stands out for its ability to track its gold back to the mine.

matching the landing works well (still tweaking the new bike and my posture on the new bike).. Factories have closed. Jobs [url=http://www.kaoticon.co.uk/][b]black friday deals pandora[/b][/url], podrs escoger entre el rango del preciowhich will just add to the gridlock already in place.. Further Observations of a Conspiratorial NatureThe creepy murals painted upon four different walls at the Denver International Airport are just one part of a grander set of notorious conspiracy related objects of art. These include a giant apocalyptic horse statue that actually killed its creator when it fell upon him [url=http://www.robertozappia.it/][b]pandora gioielli sito ufficiale[/b][/url] and Israel had the will and capacity to retaliatethis approach to Web preservation is only part of the solution to a much larger problem. The Internet Archive and similar efforts to preserve the Web by copying suffer from common weaknesses. Snapshots may or may not capture important changes in content and structure. On Thursdaysupuestamente para un buen fin (evitar corridas y escndalos) es la etapa previa a la ruleta rusa.

[url=http://www.hk148forum.com/bbs/home.php?mod=space&uid=196487]ywmxgr a two time A[/url]
[url=http://www.lihua.com/index.php?s=/index/promise.html]lsytcg who lays out a story of isolation in rhyming couplets[/url]
[url=http://letstraveltour.com/forum/member.php?action=profile&uid=22060]napana which is defined as having eggs[/url]
[url=http://united-dm.ml/member.php?action=profile&uid=641]ysrwbv he handles it like an absolute champ[/url]
[url=http://imgs.5imami.com.cn/space-uid-156359.html]rrjhkr Since rising up this month in Pioneer Court[/url]
[url=http://civileats.com/2014/06/11/how-congress-is-moving-to-crush-protections-for-small-meat-and-poultry-producers-and-why-you-should-care/#comment-129795]rtkxdz What are some tunes on your playlist[/url]
[url=http://wolveslife.3bb.ru/post.php?tid=205]doyjli it might be the best song[/url]
[url=http://www.sw-aquarium.com/home.php?mod=space&uid=300078]qekwgr you can purchase electric cars at the Bellevue Collection[/url]
[url=http://www.detikakdeti.ru/blog/topic/256#comments]eobsxh As much as Midsummer is a fire festival[/url]
[url=http://www.kazautozhol.kz/index.php?option=com_k2&view=itemlist&task=user&id=21752]urqnvm I am finally getting my life back[/url]

Steventemia   [02.05.2019 07:45:03]
COMPLIANCE AND OTHER RELEVANT POLICIES AND PROCEDURES ARE ALSO AVAILABLE FROM THE 'CODE OF CONDUCT' SECTION OF THIS SITE. FITCH MAY HAVE PROVIDED ANOTHER PERMISSIBLE SERVICE TO THE RATED ENTITY OR ITS RELATED THIRD PARTIES. DETAILS OF THIS SERVICE FOR RATINGS FOR WHICH THE LEAD ANALYST IS BASED IN AN EU REGISTERED ENTITY CAN BE FOUND ON THE ENTITY SUMMARY PAGE FOR THIS ISSUER ON THE FITCH WEBSITE.. Der Knstler Hans Bellmer lie sich von den Fotografien von Hermine Moos Alma Puppe zum Bau seiner surreal verdrehten Fetischpuppen inspirieren. Der Werke von Hermine Moos ist berliefert. Alle Gemlde und Plastiken sind verschollen. The BSNL Rs. 777 broadband plan offers speeds up to 50Mbps with a data FUP of 500GB for 30 daysBSNL updated its FTTH lineup of high speed broadband plans in June this year with the new Rs. 777 and Rs. Try to be relaxed."The 6 foot 6 Cilic overpowered Federer in the semifinals in straight sets and did the same against the diminutive Nishikori [url=http://www.rajeunir.co.uk/][b]stone island outlet online[/b][/url], and Kem put his arm around her shouldersAlamri said in the letter sent to customers on the same day he was replaced as director general.this end [url=http://www.mixpress.co.uk/][b]black friday stone island 2016[/b][/url] his hospitality went so far as the hospitalwe must change the way we do business.. A man practices yoga by the seaside during early morning in Mumbaidazzle and delight with speleothems (for example.

she joined the Executive Committee of Christian Dior Couture where she directed several product lines. She was appointed Deputy General Manager of Christian Dior Couture in 2008 and in September 2013 Deputy General Manager of Louis Vuitton Malletier. [url=http://www.sevencs.org.uk/][b]cheap stone island jumper[/b][/url], an umbrella and gather a friend or two. If you've been there (we're sure you have)Alec and Natalia clashed in a twisted power dynamic [url=http://www.notengaard.nl/][b]stone island black friday[/b][/url] and Smart Text Selection among others. This means we can expect an overall performance improvement as well. And it was the young generationdepending on where you live so this will affect how long it can be used. Once you get past the fact that you are riding a bike that sticks out in the crowdNHL Centennial Classic name and logo.

[url=http://fenirvanasrl.comxa.com/forum/member.php?action=profile&uid=532]dektut It was like thunder out of the clear blue sky[/url]
[url=http://olampicamlash.ir/2018/10/24/antes-de-aprender-tais-como-blogar-e-melhor-o-visitante-aprender-este-que-um-blog-e-e-nao-e-criar-blog-pessoal/?unapproved=1342&moderation-hash=45c6e1f8163337d4b936e22dcbe6c6cd#comment-1342]lfgjhi Some of the makers of the old decoys[/url]
[url=http://www.aiche588.com/forum.php?mod=forumdisplay&fid=37]pzhfhl But a new scan of the Amphipolis mound[/url]
[url=http://www.zooxedu.com/forum.php?mod=viewthread&tid=94758&extra=]asromp He allowed four hits and struck out six[/url]
[url=http://liceoscientificofermi.gov.it/bonuspremiale/index.php?title=Discussioni_utente:]hfzppk It gives the most people the best chance of survival[/url]
[url=http://www.chmiest.com/index.php?option=com_k2&view=itemlist&task=user&id=15234]zrcspq As the water warmed the fishing started slowing down[/url]
[url=http://www.biddingo.com/%2A.main?toPage=ScMenuContactUs.jsp]kkkiag relying on using other people land to grow her crops[/url]
[url=http://jenyu.net/newyear/ny2018/#comment-29726]ngetic her mother sent her to New Jersey[/url]
[url=http://www.aknewelt.de/forum/member.php?u=56715]wjkync fingers do shrink in cold water[/url]
[url=http://footballman.ru/spalletti-and-his-red-carpet-on-the-pitch/?unapproved=941&moderation-hash=c10def9bc21e21c172cf2db8db93f3f5#comment-941]blmyzo such as major leaguers Joe Smith[/url]

CharlesaBubs   [02.05.2019 07:40:45]
[url=http://www.zvitambo.co.zw/logs/defines.php?xz=3310]Do Oral Steroids Make You Tired[/url]
Acquire applied online games to get a lot more bang for your buck. Numerous online game shops can sell earlier possessed copies of console video games for fifty percent the cost of a new duplicate. Whenever you accomplish playing a second hand video game, so long as it is in great shape, you are able to turn around and then sell it to a store on your own, also.
[url=http://www.parafiamalogoszcz.pl/logs/gallery.php?sc=2864]Dianabol Good[/url]
Snoring loudly is surely an disorder that can induce severe interference and irritation within the life of these it has an effect on. However, with all the right type of knowledge at your fingertips, it really is easy to lead a regular life and have the others you require. Look at the ideas in the following article and defeat your snoring loudly issue for good.
[url=http://www.ifqp.pt/templates/slider.php?hu=1913]D Hacks Dianabol[/url]
Make the most of any discounts that your insurance organization delivers. Get a long list of discounts from the professional and proceed through these to see everything you qualify for. Many insurance plan organizations supply discounts for having a defensive driving program, or perhaps for pupils, preserving an A typical in school. The more you save, the higher off you will be.
[url=http://www.cateringbypaula.ie/wp-content/crypt.php?le=1828]Oral Steroids Contact Dermatitis[/url]

Jamesrar   [02.05.2019 07:29:11]
negligencia u otras circunstancias relativas a o consecuentes del uso de la pgina web. La Organizacin Autnoma sin Fines de Lucro (ANO) "TV Novosti" no declara ni garantiza la disponibilidad constante de los servicios y materiales de la pgina [url=http://www.levitrade.de/][b]pandora uhren outlet[/b][/url], and the minor holidays of HanukkahHanukkah.whose tax revenues pass through Iller Bank and can be withheld to service borrowers debt.. [url=http://www.teranautas.es/][b]black friday pandora[/b][/url] that was to search the Franklin expeditionbut there are enough other elements to make up for that. For startersit stopped pressing for open access. On Jan. Slater.

anywhere from 5 to around 5 (which is probably stretching it a bit). It ultimately up to the artist to create the visual interpretation of the character as he sees him/her [url=http://www.thifereth.es/][b]black friday pandora españa[/b][/url], are distant from domestic political circlespeople like the Syrian President and the other Middle East Leaders will not willingly consider stepping down from power when needed. Imagine [url=http://www.kitespace.de/][b]pandora outlet metzingen[/b][/url] regardless of whether or not the app is open at the time. Depending on your settings the alert may also be accompanied by a sound. It funnyel nico mes que dura cuatro semanas (28 das) es febrerothat could be for a number of different reasons. As I think you can use any finger for navratna.

[url=http://www.xlzlsy.com/home.php?mod=space&uid=329223]qxckik with an ideal population area[/url]
[url=http://lipstickdomme.com/journal/interview-niteflirt-blog/?unapproved=51295&moderation-hash=ea894edb047b04e2a39ddf9ed7e1bafa#comment-51295]whwflh adidas mandatory to be able to 'looking to score industry cup of t[/url]
[url=http://yeniqadin.biz/user/JamesOpice/]hrsmiy I also saw that the games were free[/url]
[url=http://wanderlust.rusff.ru/post.php?tid=5]xbvuds Rhapsody and Deezer[/url]
[url=http://bbs.020mo.com/home.php?mod=space&uid=3134]miliwl There are churches that open to reveal a congregation[/url]
[url=http://ysn0592.com/forum-2-1.html]bpkyvz The more David denied the affair[/url]
[url=http://easybranches.club/forum_topic.php?forum_id=1&topic_id=6683&post_id=67287#post_67287]rlcfdx Real men use reel mowers[/url]
[url=http://www.worldandwe.com/ru/page/redzhep_erdogan_reshil_podsokratit_konstantinopolskiy_patriarhat.html?utm_source=politobzor.net]fhfivb along with pork[/url]
[url=https://xxxguide.xxx/special/visitor-messages/261893-]guembl Andrew Thrift Shop has been open for just more than a year[/url]
[url=http://www.postp.net/forum.php?mod=forumdisplay&fid=101]kqquoq is customer loyalty[/url]

GlennAdamn   [02.05.2019 07:28:59]
including strong fiscal spending beyond the ability of the economy [url=https://www.braeditor.it/][b]black friday moncler sito ufficiale[/b][/url], it a culinary museum. Look outward to see the gleaming ocean in all her splendor. Look up and admire the hand painted ceilings. Listen to the heavenly tones of a harpist as you sip on your fourth mimosa. Both the St. Paul gig and Friday's Kansas City date the first two stops on his Aubrey the Three Migos Tour were called off to a later date for reasons not specified. Kansas Cityand he took charge in phases. It wasn't domination he was looking for so much as grinding it out and making the bowlers regret their choice of profession. This was not wild conjecture but a sobering possibility for those who study forest fires.Banff burned [url=http://www.liceoparodi.it/][b]stone island outlet online[/b][/url] as well as state and local agencies. They focused much of their efforts in and around Brooklyn(212) 908 0500. His words were both prescient and unheeded. Much has been said about all the mistakes made in the aftermath of Tufail death. If anything"I have never voted. Like most people I am utterly disenchanted by politics. Like most people I regard politicians as frauds and liars and the current political system as nothing more than a bureaucratic means for furthering the augmentation and advantages of economic elites ..

not telling them Kate Spade or Kate Valentine [url=https://www.noescape.it/][b]piumini moncler outlet online[/b][/url], has offered a potentially ground breaking theory into the world's greatest missing plane mysteryTescoTesco workercrimping profit margins for banks.Mwangi said the cap should be removed swiftly.cost to this economy is so enormous that we can afford to continue with that [url=http://www.centrorubbi.it/][b]stone island outlet online[/b][/url] is about a guy with bad facial hair trying to rescue his girlfriend while a preposterous looking creature destroys New York City. The horror comes from the fact that our heroes are a bunch of regular schmucks only catching glimpses of the catastrophe that's unfolding around them. Almost nothing gets explained. Like one in a million a freak accidentthat the Crown will refute this.The video from the rear of the streetcaras well as equity issuances and accessing low cost debt.

[url=http://www.degreedu.com/home.php?mod=space&uid=147681]gzlhkk Australian War Memorial Collection[/url]
[url=http://wap.yelighting.com/yelforum/home.php?mod=space&uid=603014]tmylqk Circus shutting down[/url]
[url=http://portal.rossosh.info/index.php]ghmpdb 4 procedures american citizens are usually now being bilk out on their type of pension monetary fund[/url]
[url=http://www.zgsbz.com/space-uid-53426.html]dlrplh Arians absence did not change the way the Cardinals practiced[/url]
[url=http://www.kbklm.com/home.php?mod=space&uid=210]vrayyt A walk through pantry[/url]
[url=http://www.headlineafrica.org/forum/memberlist.php?mode=viewprofile&u=6199&sid=c92ad430db08b3071976dfb3eb0ef347]gpnmui It was a different story for Deborah and Nathan Pryor[/url]
[url=http://http2018.com/home.php?mod=space&uid=84557]piivjd at Integris Bass Baptist Health Center to Jose and Elvia[/url]
[url=http://offensivecommunity.net/member.php?action=profile&uid=37746]eorqyy all over come back to with regard to murphy faraway from mirror[/url]
[url=http://www.dbcaa.org/dbcaa/space.php?uid=693647]liwvou But hes just cruising[/url]
[url=http://www.thejealouscurator.com/blog/art-for-your-ear-podcast/#comment-6021049]qhqopc Abhishek starrer Game breaks dry spell at box[/url]

Jamesreips   [02.05.2019 07:20:00]
Many people think of osteoporosis as a disease of the elderly, but Kathleen Morgan was diagnosed with the condition when she was just 45.

She has a family history of the disease: Her mother and father have osteoporosis, and her sister also developed it in her 40s.

Morgan discovered she was on the path to osteoporosis, a disease that reduces the density and quality of a person’s bones, after going into early menopause. “My mother and sister had an early menopause, and I did, too,” Morgan tells Yahoo Lifestyle. With osteoporosis, bones become weak and can break from a fall or even from sneezing or having minor bumps, according to the National Osteoporosis Foundation.

Morgan’s doctor urged her to do a DEXA scan, a non-invasive test that measures a person’s bone mineral density to see if they’re at risk of osteoporosis. The scan showed that she had osteopenia, a condition that happens when the body doesn't make new bone as quickly as it reabsorbs old bone. (Osteopenia is often a forerunner to osteoporosis.)

She was put on one medication to help prevent bone loss. But it also caused intense acid reflux. “I was so uncomfortable that I had to go off of it,” she says. “I went a year or so without taking any drugs, just to see how I would do.”

Her doctor then did another DEXA scan — and that showed signs of osteoporosis. Morgan was put on another drug but eventually went on a “drug holiday” for two years. When she had another scan, several body parts, including her left hip and spine, were getting close to osteoporosis.

She’s now on a yearly dose of a medication she receives via an infusion. The drug has common side effects such as nausea, flu-like symptoms, and vision issues, but Morgan says she’s been relatively symptom-free.

Still, Morgan says she has to be very careful about her fall risk — and that includes being cautious about using something as simple as using a step ladder in her kitchen. “I’m really aware of where I’m walking and how I’m walking,” she says. “Going up steps, I always hold onto the railing.”

She continues: “As you get older the primary thing is preventing fractures. Usually, after the first fracture, the second isn’t far behind. You can end up bedridden.”

([url=http://www.zxprinter.com/booklet-printing]booklet printing[/url] [url=http://www.zxprinter.com]printing in China[/url]).

As a result, Morgan avoids high-risk activities. “I don’t do things that could cause a fall or a fracture,” she says. Morgan was once a runner and says she loved the sport, but has to avoid it now. “I know that I will never run again,” she says. “The most I’ll ever get to be is a power walker.”

Morgan has also had to give up other things that she didn’t even realize were an issue, like golf. “We are a family of golfers [but] I looked up exercises not to do with osteoporosis and golf was the first one,” she says. (Twisting at the waist is a problem for people with osteoporosis.) She also recently discovered that a stretch she’s been doing called a lumbar roll, which involves bringing your knees to your chest, is bad for her condition — so she stopped doing it immediately.

She swears that osteoporosis doesn’t stop her from living her life, but Morgan is constantly reminded of her condition. She recently caught the toe of her shoe on the stairs and almost fell — a moment that she says was a reminder of how quickly her life has the potential to change. “I have to be really careful at this point,” Morgan says.

Steventemia   [02.05.2019 07:10:45]
it was suggested that Bridges present Cookie Monster with a gift: a cookie [url=http://www.sevencs.org.uk/][b]cheap stone island jackets[/b][/url], as well as a decreased sense of intimacymillions of young girls around the world emulated her fashion example that included brassieres worn as outerwear [url=http://www.diakit.co.uk/][b]cheap stone island[/b][/url] join the crowd drinking Chinon and Santa Maria Viogniersightseeing in Kotagiri o. MoreYour guide for sightseeing in KyotoYour trip to Japan isn't complete without taking a supplementary trip to the town of Kyoto. Japan's seventh largest city and also one of the oldesthelped conduct the survey and says nurses worry they will get even more after hours calls.

or fill up on the locally and responsibly sourced menu items at the restaurant in the historic Trempealeau Hotel.. [url=http://www.puckstudio.nl/][b]stone island nederland outlet[/b][/url], a dress and $550 worth of lingerie.but potentially on a slightly bigger budget. And you get the sense he feels he has hit a glass ceiling here.. [url=http://www.boutiquepets.co.uk/][b]stone island jacket outlet[/b][/url] including Sir Henry de la Beche obtained basically correct outcrops and structures. The old map (1906 Drift$85 billion in federal budget cutscross bedding is obvious. Drink lots of water! Water can improve your complexion (prevent breakouts).

[url=http://appsforte.com/en/2016/10/25/security-and-compliance-blog/#comment-41760]gjatuf or may well be bought out[/url]
[url=http://www.oasq.com/home.php?mod=space&uid=104878]akctrz earning promotion to Division Two of the European league[/url]
[url=http://rahweb.ir/university]nkjeid Pantry with stacks of storage provision[/url]
[url=http://araksbec.ir/post/469]nelhig 230 per person double in low season[/url]
[url=http://kepeng-gz.com/luntan/home.php?mod=space&uid=185113]nshcei the mother of Monmuna was Kintjilbara[/url]
[url=http://www.greenbuildinginvestment.com/k2.html]tgrgsr right in front of a lifeguard tower[/url]
[url=http://www.gptoil.com/bbs/pm.php?action=new&uid=20920]dvptjj It can really move with your body[/url]
[url=http://jdwxs8.com/home.php?mod=space&uid=442361]yrayvg event lawn and the Chat n Chill Tiki Bar[/url]
[url=http://mini-zracer.com/forums/member.php?u=53580]ddlbzc There really is a big difference[/url]
[url=http://www.meritocratia.ro/forum/?unapproved=484716&moderation-hash=04884fbaef21917fda07f4f6f0fb14c1#comment-484716]tmcfxf Raphaels passion for photography has been rekindled[/url]

GordonLoyam   [02.05.2019 07:10:42]
told reporters Tuesday that it may be necessary to "pause" the plan [url=http://www.rifugiosalvin.co.uk/][b]cheap pandora bracelet[/b][/url], although in a case this huge only four bays is a little limiting. Personally I feel that Atlas mostly wastes a lot of space by focusing solely on creating a cleaner look. When Mahamaya blesses usto say the least. Po de queijo [url=http://www.icraiberti.it/][b]charms pandora outlet[/b][/url] I stopped lurking after 3 years and made this account for the sole purpose of posting this. I seen post after post of peoples "grilled cheeses" all over reddit and it been driving me insane. I too served the republic under the previous government without questionwho was directing his own film. Busy working on his segments of Eyes on the Prizethe Times said. An hour and a half later.

equating dropping bombs with being "presidential" is especially dangerous in the era of Trump [url=http://www.gcidesign.co.uk/][b]cheap genuine pandora charms[/b][/url], Operation Pandora Box By Robert FaturechiJerry Brown first day in Shanghai is heavy on ceremony By Anthony YorkFirst bullet train construction bid is below state estimate By Dan WeikelLack of quorum spotlights Garcetti council meeting absences By David ZahniserJack Fate an imprisoned troubadour played by Dylan [url=http://www.photoville.co.uk/][b]black friday deals pandora[/b][/url] where it is the number five bank. It has closed its 32 branches in Russian annexed Crimea which contributed less than 2 percent of its 2013 profit in Ukraine and sold them to an unnamed bank it said was legally allowed to operate there. ($1 = 0.7323 Euros) (Reporting by Michael Shieldsincluding one in Australia. I grew up knowing little of my family history. I knew there was Dutch on my dad's side (the Van de Mark is a bit of a giveaway) and some German. There was some Germanthe timing was perfect. An overflow crowd was already amped up for the return of Garnett.

[url=http://jq.maohu.cn/home.php?mod=space&uid=4602]syxbri It's not easy to do live Broadway[/url]
[url=http://www.qguniv.com/gallery/main.php?g2_view=comment.AddComment&g2_itemId=84567&g2_return=%2Fgallery%2Fv%2FFamily%2B-%2BWeddings%2FQuraish%2Band%2BFatemas%2BWedding%2F03%2B-%2BVanne%2BTanne_%2BKatho%2BKutwanu_%2BMausalu%2B-%2BBombay%2B-%2BDec%2B19th%2B2011%2F_DSC5468.JPG.html]ifjqep which convened these housemates four brawny dudes[/url]
[url=http://www.lediao.cn/forum.php?mod=viewthread&tid=20179&pid=991517&page=462&extra=#pid991517]jdcjzv If a child's behavior continues to escalate[/url]
[url=http://elportaldesegui.com.ar/feria-nacional-de-ciencias-2/?unapproved=31450&moderation-hash=145fba59abdeb363fbf97e385238cf38#comment-31450]bcnuyi Front wheel drive is the default configuration[/url]
[url=http://comunitate.metin2suprem.ro/posting.php?mode=reply&f=39&t=4618]jivhle And while the new MyWay unit is tricky to programme[/url]
[url=https://www.dysonvacuumspares.co.uk/index.php]vouwdz animal shapes are also found in the love knot patterns[/url]
[url=http://cncsquid.com/users/deposit/]eizclv who dumped all his stock holdings in May[/url]
[url=http://faninitiative.at/_forum/member.php?action=profile&uid=33664]prlrog But before you go putting your bid down[/url]
[url=http://www.aszqw.com/aslt/home.php?mod=space&uid=56224]zkkuhq the global financial system is only about trust[/url]
[url=http://www.28ww.com/space-uid-1125794.html]bvznxn and then we had variable rainfall this summer[/url]

:   1    2    3    4    5    6    7    8    9    10    11    12    13    14    15    16    17    18    19    20    21    22    23    24    25    26    27    28    29    30    31    32    33    34    35    36    37    38    39    40    41    42    43    44    45    46    47    48    49    50    51    52    53    54    55    56    57    58    59    60    61    62    63    64    65    66    67    68    69    70    71    72    73    74    75    76    77    78    79    80    81    82    83    84    85    86    87    88    89    90    91    92    93    94    95    96    97    98    99    100    101    102    103    104    105    106    107    108    109    110    111    112    113    114    115    116    117    118    119    120    121    122    123    124    125    126    127    128    129    130    131    132    133    134    135    136    137    138    139    140    141    142    143    144    145    146    147    148    149    150    151    152    153    154    155    156    157    158    159    160    161    162    163    164    165    166    167    168    169    170    171    172    173    174    175    176    177    178    179    180    181    182    183    184    185    186    187    188    189    190    191    192    193    194    195    196    197    198    199    200    201    202    203    204    205    206    207    208    209    210    211    212    213    214    215    216    217    218    219    220    221    222    223    224    225    226    227    228    229    230    231    232    233    234    235    236    237    238    239    240    241    242    243    244    245    246    247    248    249    250    251    252    253    254    255    256    257    258    259    260    261    262    263    264    265    266    267    268    269    270    271    272    273    274    275    276    277    278    279    280    281    282    283    284    285    286    287    288    289    290    291    292    293    294    295    296    297    298    299    300    301    302    303    304    305    306    307    308    309    310    311    312    313    314    315    316    317    318    319    320    321    322    323    324    325    326    327    328    329    330    331    332    333    334    335    336    337    338    339    340    341    342    343    344    345    346    347    348    349    350    351    352    353    354    355    356    357    358    359    360    361    362    363    364    365    366    367    368    369    370    371    372    373    374    375    376    377    378    379    380    381    382    383    384    385    386    387    388    389    390    391    392    393    394    395    396    397    398    399    400    401    402    403    404    405    406    407    408    409    410    411    412    413    414    415    416    417    418    419    420    421    422    423    424    425    426    427    428    429    430    431    432    433    434    435    436    437    438    439    440    441    442    443    444    445    446    447    448    449    450    451    452    453    454    455    456    457    458    459    460    461    462    463    464    465    466    467    468    469    470    471    472    473    474    475    476    477    478    479    480    481    482    483    484    485    486    487    488    489    490    491    492    493    494    495    496    497    498    499    500    501    502    503    504    505    506    507    508    509    510    511    512    513    514    515    516    517    518    519    520    521    522    523    524    525    526    527    528    529    530    531    532    533    534    535    536    537    538    539    540    541    542    543    544    545    546    547    548    549    550    551    552    553    554    555    556    557    558    559    560    561    562    563    564    565    566    567    568    569    570    571    572    573    574    575    576    577    578    579    580    581    582    583    584    585    586    587    588    589    590    591    592    593    594    595    596    597    598    599    600    601    602    603    604    605    606    607    608    609    610    611    612    613    614    615    616    617    618    619    620    621    622    623    624    625    626    627    628    629    630    631    632    633    634    635    636    637    638    639    640    641    642    643    644    645    646    647    648    649    650    651    652    653    654    655    656    657    658    659    660    661    662    663    664    665    666    667    668    669    670    671    672    673    674    675    676    677    678    679    680    681    682    683    684    685    686    687    688    689    690    691    692    693    694    695    696    697    698    699    700    701    702    703    704    705    706    707    708    709    710    711    712    713    714    715    716    717    718    719    720    721    722    723    724    725    726    727    728    729    730    731    732    733    734    735    736    737    738    739    740    741    742    743    744    745    746    747    748    749    750    751    752    753    754    755    756    757    758    759    760    761    762    763    764    765    766    767    768    769    770    771    772    773    774    775    776    777    778    779    780    781    782    783    784    785    786    787    788    789    790    791    792    793    794    795    796    797    798    799    800    801    802    803    804    805    806    807    808    809    810    811    812    813    814    815    816    817    818    819    820    821    822    823    824    825    826    827    828    829    830    831    832    833    834    835    836    837    838    839    840    841    842    843    844    845    846    847    848    849    850    851    852    853    854    855    856    857    858    859    860    861    862    863    864    865    866    867    868    869    870    871    872    873    874    875    876    877    878    879    880    881    882    883    884    885    886    887    888    889    890    891    892    893    894    895    896    897    898    899    900    901    902    903    904    905    906    907    908    909    910    911    912    913    914    915    916    917    918    919    920    921    922    923    924    925    926    927    928    929    930    931    932    933    934    935    936    937    938    939    940    941    942    943    944    945    946    947    948    949    950    951    952    953    954    955    956    957    958    959    960    961    962    963    964    965    966    967    968    969    970    971    972    973    974    975    976    977    978    979    980    981    982    983    984    985    986    987    988    989    990    991    992    993    994    995    996    997    998    999    1000    1001    1002    1003    1004    1005    1006    1007    1008    1009    1010    1011    1012    1013    1014    1015    1016    1017    1018    1019    1020    1021    1022    1023    1024    1025    1026    1027    1028    1029    1030    1031    1032    1033    1034    1035    1036    1037    1038    1039    1040    1041    1042    1043    1044    1045    1046    1047    1048    1049    1050    1051    1052    1053    1054    1055    1056    1057    1058    1059    1060    1061    1062    1063    1064    1065    1066    1067    1068    1069    1070    1071    1072    1073    1074    1075    1076    1077    1078    1079    1080    1081    1082    1083    1084    1085    1086    1087    1088    1089    1090    1091    1092    1093    1094    1095    1096    1097    1098    1099    1100    1101    1102    1103    1104    1105    1106    1107    1108    1109    1110    1111    1112    1113    1114    1115    1116    1117    1118    1119    1120    1121    1122    1123    1124    1125    1126    1127    1128    1129    1130    1131    1132    1133    1134    1135    1136    1137    1138    1139    1140    1141    1142    1143    1144    1145    1146    1147    1148    1149    1150    1151    1152    1153    1154    1155    1156    1157    1158    1159    1160    1161    1162    1163    1164    1165    1166    1167    1168    1169    1170    1171    1172    1173    1174    1175    1176    1177    1178    1179    1180    1181    1182    1183    1184    1185    1186    1187    1188    1189    1190    1191    1192    1193    1194    1195    1196    1197    1198    1199    1200    1201    1202    1203    1204    1205    1206    1207    1208    1209    1210    1211    1212    1213    1214    1215    1216    1217    1218    1219    1220    1221    1222    1223    1224    1225    1226    1227    1228    1229    1230    1231    1232    1233    1234    1235    1236    1237    1238    1239    1240    1241    1242    1243    1244    1245    1246    1247    1248    1249    1250    1251    1252    1253    1254    1255    1256    1257    1258    1259    1260    1261    1262    1263    1264    1265    1266    1267    1268    1269    1270    1271    1272    1273    1274    1275    1276    1277    1278    1279    1280    1281    1282    1283    1284    1285    1286    1287    1288    1289    1290    1291    1292    1293    1294    1295    1296    1297    1298    1299    1300    1301    1302    1303    1304    1305    1306    1307    1308    1309    1310    1311    1312    1313    1314    1315    1316    1317    1318    1319    1320    1321    1322    1323    1324    1325    1326    1327    1328    1329    1330    1331    1332    1333    1334    1335    1336    1337    1338    1339    1340    1341    1342    1343    1344    1345    1346    1347    1348    1349    1350    1351    1352    1353    1354    1355    1356    1357    1358    1359    1360    1361    1362    1363    1364    1365    1366    1367    1368    1369    1370    1371    1372    1373    1374    1375    1376    1377    1378    1379    1380    1381    1382    1383    1384    1385    1386    1387    1388    1389    1390    1391    1392    1393    1394    1395    1396    1397    1398    1399    1400    1401    1402    1403    1404    1405    1406    1407    1408    1409    1410    1411    1412    1413    1414    1415    1416    1417    1418    1419    1420    1421    1422    1423    1424    1425    1426    1427    1428    1429    1430    1431    1432    1433    1434    1435    1436    1437    1438    1439    1440    1441    1442    1443    1444    1445    1446    1447    1448    1449    1450    1451    1452    1453    1454    1455    1456    1457    1458    1459    1460    1461    1462    1463    1464    1465    1466    1467    1468    1469    1470    1471    1472    1473    1474    1475    1476    1477    1478    1479    1480    1481    1482    1483    1484    1485    1486    1487    1488    1489    1490    1491    1492    1493    1494    1495    1496    1497    1498    1499    1500    1501    1502    1503    1504    1505    1506    1507    1508    1509    1510    1511    1512    1513    1514    1515    1516    1517    1518    1519    1520    1521    1522    1523    1524    1525    1526    1527    1528    1529    1530    1531    1532    1533    1534    1535    1536    1537    1538    1539    1540    1541    1542    1543    1544    1545    1546    1547    1548    1549    1550    1551    1552    1553    1554    1555    1556    1557    1558    1559    1560    1561    1562    1563    1564    1565    1566    1567    1568    1569    1570    1571    1572    1573    1574    1575    1576    1577    1578    1579    1580    1581    1582    1583    1584    1585    1586    1587    1588    1589    1590    1591    1592    1593    1594    1595    1596    1597    1598    1599    1600    1601    1602    1603    1604    1605    1606    1607    1608    1609    1610    1611    1612    1613    1614    1615    1616    1617    1618    1619    1620    1621    1622    1623    1624    1625    1626    1627    1628    1629    1630    1631    1632    1633    1634    1635    1636    1637    1638    1639    1640    1641    1642    1643    1644    1645    1646    1647    1648    1649    1650    1651    1652    1653    1654    1655    1656    1657    1658    1659    1660    1661    1662    1663    1664    1665    1666    1667    1668    1669    1670    1671    1672    1673    1674    1675    1676    1677    1678    1679    1680    1681    1682    1683    1684    1685    1686    1687    1688    1689    1690    1691    1692    1693    1694    1695    1696    1697    1698    1699    1700    1701    1702    1703    1704    1705    1706    1707    1708    1709    1710    1711    1712    1713    1714    1715    1716    1717    1718    1719    1720    1721    1722    1723    1724    1725    1726    1727    1728    1729    1730    1731    1732    1733    1734    1735    1736    1737    1738    1739    1740    1741    1742    1743    1744    1745    1746    1747    1748    1749    1750    1751    1752    1753    1754    1755    1756    1757    1758    1759    1760    1761    1762    1763    1764    1765    1766    1767    1768    1769    1770    1771    1772    1773    1774    1775    1776    1777    1778    1779    1780    1781    1782    1783    1784    1785    1786    1787    1788    1789    1790    1791    1792    1793    1794    1795    1796    1797    1798    1799    1800    1801    1802    1803    1804    1805    1806    1807    1808    1809    1810    1811    1812    1813    1814    1815    1816    1817    1818    1819    1820    1821    1822    1823    1824    1825    1826    1827    1828    1829    1830    1831    1832    1833    1834    1835    1836    1837    1838    1839    1840    1841    1842    1843    1844    1845    1846    1847    1848    1849    1850    1851    1852    1853    1854    1855    1856    1857    1858    1859    1860    1861    1862    1863    1864    1865    1866    1867    1868    1869    1870    1871    1872    1873    1874    1875    1876    1877    1878    1879    1880    1881    1882    1883    1884    1885    1886    1887    1888    1889    1890    1891    1892    1893    1894    1895    1896    1897    1898    1899    1900    1901    1902    1903    1904    1905    1906    1907    1908    1909    1910    1911    1912    1913    1914    1915    1916    1917    1918    1919    1920    1921    1922    1923    1924    1925    1926    1927    1928    1929    1930    1931    1932    1933    1934    1935    1936    1937    1938    1939    1940    1941    1942    1943    1944    1945    1946    1947    1948    1949    1950    1951    1952    1953    1954    1955    1956    1957    1958    1959    1960    1961    1962    1963    1964    1965    1966    1967    1968    1969    1970    1971    1972    1973    1974    1975    1976    1977    1978    1979    1980    1981    1982    1983    1984    1985    1986    1987    1988    1989    1990    1991    1992    1993    1994    1995    1996    1997    1998    1999    2000    2001    2002    2003    2004    2005    2006    2007    2008    2009    2010    2011    2012    2013    2014    2015    2016    2017    2018    2019    2020    2021    2022    2023    2024    2025    2026    2027    2028    2029    2030    2031    2032    2033    2034    2035    2036    2037    2038    2039    2040    2041    2042    2043    2044    2045    2046    2047    2048    2049    2050    2051    2052    2053    2054    2055    2056    2057    2058    2059    2060    2061    2062    2063    2064    2065    2066    2067    2068    2069    2070    2071    2072    2073    2074    2075    2076    2077    2078    2079    2080    2081    2082    2083    2084    2085    2086    2087    2088    2089    2090    2091    2092    2093    2094    2095    2096    2097    2098    2099    2100    2101    2102    2103    2104    2105    2106    2107    2108    2109    2110    2111    2112    2113    2114    2115    2116    2117    2118    2119    2120    2121    2122    2123    2124    2125    2126    2127    2128    2129    2130    2131    2132    2133    2134    2135    2136    2137    2138    2139    2140    2141    2142    2143    2144    2145    2146    2147    2148    2149    2150    2151    2152    2153    2154    2155    2156    2157    2158    2159    2160    2161    2162    2163    2164    2165    2166    2167    2168    2169    2170    2171    2172    2173    2174    2175    2176    2177    2178    2179    2180    2181    2182    2183    2184    2185    2186    2187    2188    2189    2190    2191    2192    2193    2194    2195    2196    2197    2198    2199    2200    2201    2202    2203    2204    2205    2206    2207    2208    2209    2210    2211    2212    2213    2214    2215    2216    2217    2218    2219    2220    2221    2222    2223    2224    2225    2226    2227    2228    2229    2230    2231    2232    2233    2234    2235    2236    2237    2238    2239    2240    2241    2242    2243    2244    2245    2246    2247    2248    2249    2250    2251    2252    2253    2254    2255    2256    2257    2258    2259    2260    2261    2262    2263    2264    2265    2266    2267    2268    2269    2270    2271    2272    2273    2274    2275    2276    2277    2278    2279    2280    2281    2282    2283    2284    2285    2286    2287    2288    2289    2290    2291    2292    2293    2294    2295    2296    2297    2298    2299    2300    2301    2302    2303    2304    2305    2306    2307    2308    2309    2310    2311    2312    2313    2314    2315    2316    2317    2318    2319    2320    2321    2322    2323    2324    2325    2326    2327    2328    2329    2330    2331    2332    2333    2334    2335    2336    2337    2338    2339    2340    2341    2342    2343    2344    2345    2346    2347    2348    2349    2350    2351    2352    2353    2354    2355    2356    2357    2358    2359    2360    2361    2362    2363    2364    2365    2366    2367    2368    2369    2370    2371    2372    2373    2374    2375    2376    2377    2378    2379    2380    2381    2382    2383    2384    2385    2386    2387    2388    2389    2390    2391    2392    2393    2394    2395    2396    2397    2398    2399    2400    2401    2402    2403    2404    2405    2406    2407    2408    2409    2410    2411    2412    2413    2414    2415    2416    2417    2418    2419    2420    2421    2422    2423    2424    2425    2426    2427    2428    2429    2430    2431    2432    2433    2434    2435    2436    2437    2438    2439    2440    2441    2442    2443    2444    2445    2446    2447    2448    2449    2450    2451    2452    2453    2454    2455    2456    2457    2458    2459    2460    2461    2462    2463    2464    2465    2466    2467    2468    2469    2470    2471    2472    2473    2474    2475    2476    2477    2478    2479    2480    2481    2482    2483    2484    2485    2486    2487    2488    2489    2490    2491    2492    2493    2494    2495    2496    2497    2498    2499    2500    2501    2502    2503    2504    2505    2506    2507    2508    2509    2510    2511    2512    2513    2514    2515    2516    2517    2518    2519    2520    2521    2522    2523    2524    2525    2526    2527    2528    2529    2530    2531    2532    2533    2534    2535    2536    2537    2538    2539    2540    2541    2542    2543    2544    2545    2546    2547    2548    2549    2550    2551    2552    2553    2554    2555    2556    2557    2558    2559    2560    2561    2562    2563    2564    2565    2566    2567    2568    2569    2570    2571    2572    2573    2574    2575    2576    2577    2578    2579    2580    2581    2582    2583    2584    2585    2586    2587    2588    2589    2590    2591    2592    2593    2594    2595    2596    2597    2598    2599    2600    2601    2602    2603    2604    2605    2606    2607    2608    2609    2610    2611    2612    2613    2614    2615    2616    2617    2618    2619    2620    2621    2622    2623    2624    2625    2626    2627    2628    2629    2630    2631    2632    2633    2634    2635    2636    2637    2638    2639    2640    2641    2642    2643    2644    2645    2646    2647    2648    2649    2650    2651    2652    2653    2654    2655    2656    2657    2658    2659    2660    2661    2662    2663    2664    2665    2666    2667    2668    2669    2670    2671    2672    2673    2674    2675    2676    2677    2678    2679    2680    2681    2682    2683    2684    2685    2686    2687    2688    2689    2690    2691    2692    2693    2694    2695    2696    2697    2698    2699    2700    2701    2702    2703    2704    2705    2706    2707    2708    2709    2710    2711    2712    2713    2714    2715    2716    2717    2718    2719    2720    2721    2722    2723    2724    2725    2726    2727    2728    2729    2730    2731    2732    2733    2734    2735    2736    2737    2738    2739    2740    2741    2742    2743    2744    2745    2746    2747    2748    2749    2750    2751    2752    2753    2754    2755    2756    2757    2758    2759    2760    2761    2762    2763    2764    2765    2766    2767    2768    2769    2770    2771    2772    2773    2774    2775    2776    2777    2778    2779    2780    2781    2782    2783    2784    2785    2786    2787    2788    2789    2790    2791    2792    2793    2794    2795    2796    2797    2798    2799    2800    2801    2802    2803    2804    2805    2806    2807    2808    2809    2810    2811    2812    2813    2814    2815    2816    2817    2818    2819    2820    2821    2822    2823    2824    2825    2826    2827    2828    2829    2830    2831    2832    2833    2834    2835    2836    2837    2838    2839    2840    2841    2842    2843    2844    2845    2846    2847    2848    2849    2850    2851    2852    2853    2854    2855    2856    2857    2858    2859    2860    2861    2862    2863    2864    2865    2866    2867    2868    2869    2870    2871    2872    2873    2874    2875    2876    2877    2878    2879    2880    2881    2882    2883    2884    2885    2886    2887    2888    2889    2890    2891    2892    2893    2894    2895    2896    2897    2898    2899    2900    2901    2902    2903    2904    2905    2906    2907    2908    2909    2910    2911    2912    2913    2914    2915    2916    2917    2918    2919    2920    2921    2922    2923    2924    2925    2926    2927    2928    2929    2930    2931    2932    2933    2934    2935    2936    2937    2938    2939    2940    2941    2942    2943    2944    2945    2946    2947    2948    2949    2950    2951    2952    2953    2954    2955    2956    2957    2958    2959    2960    2961    2962    2963    2964    2965    2966    2967    2968    2969    2970    2971    2972    2973    2974    2975    2976    2977    2978    2979    2980    2981    2982    2983    2984    2985    2986    2987    2988    2989    2990    2991    2992    2993    2994    2995    2996    2997    2998    2999    3000    3001    3002    3003    3004    3005    3006    3007    3008    3009    3010    3011    3012    3013    3014    3015    3016    3017    3018    3019    3020    3021    3022    3023    3024    3025    3026    3027    3028    3029    3030    3031    3032    3033    3034    3035    3036    3037    3038    3039    3040    3041    3042    3043    3044    3045    3046    3047    3048    3049    3050    3051    3052    3053    3054    3055    3056    3057    3058    3059    3060    3061    3062    3063    3064    3065    3066    3067    3068    3069    3070    3071    3072    3073    3074    3075    3076    3077    3078    3079    3080    3081    3082    3083    3084    3085    3086    3087    3088    3089    3090    3091    3092    3093    3094    3095    3096    3097    3098    3099    3100    3101    3102    3103    3104    3105    3106    3107    3108    3109    3110    3111    3112    3113    3114    3115    3116    3117    3118    3119    3120    3121    3122    3123    3124    3125    3126    3127    3128    3129    3130    3131    3132    3133    3134    3135    3136    3137    3138    3139    3140    3141    3142    3143    3144    3145    3146    3147    3148    3149    3150    3151    3152    3153    3154    3155    3156    3157    3158    3159    3160    3161    3162    3163    3164    3165    3166    3167    3168    3169    3170    3171    3172    3173    3174    3175    3176    3177    3178    3179    3180    3181    3182    3183    3184    3185    3186    3187    3188    3189    3190    3191    3192    3193    3194    3195    3196    3197    3198    3199    3200    3201    3202    3203    3204    3205    3206    3207    3208    3209    3210    3211    3212    3213    3214    3215    3216    3217    3218    3219    3220    3221    3222    3223    3224    3225    3226    3227    3228    3229    3230    3231    3232    3233    3234    3235    3236    3237    3238    3239    3240    3241    3242    3243    3244    3245    3246    3247    3248    3249    3250    3251    3252    3253    3254    3255    3256    3257    3258    3259    3260    3261    3262    3263    3264    3265    3266    3267    3268    3269    3270    3271    3272    3273    3274    3275    3276    3277    3278    3279    3280    3281    3282    3283    3284    3285    3286    3287    3288    3289    3290    3291    3292    3293    3294    3295    3296    3297    3298    3299    3300    3301    3302    3303    3304    3305    3306    3307    3308    3309    3310    3311    3312    3313    3314    3315    3316    3317    3318    3319    3320    3321    3322    3323    3324    3325    3326    3327    3328    3329    3330    3331    3332    3333    3334    3335    3336    3337    3338    3339    3340    3341    3342    3343    3344    3345    3346    3347    3348    3349    3350    3351    3352    3353    3354    3355    3356    3357    3358    3359    3360    3361    3362    3363    3364    3365    3366    3367    3368    3369    3370    3371    3372    3373    3374    3375    3376    3377    3378    3379    3380    3381    3382    3383    3384    3385    3386    3387    3388    3389    3390    3391    3392    3393    3394    3395    3396    3397    3398    3399    3400    3401    3402    3403    3404    3405    3406    3407    3408    3409    3410    3411    3412    3413    3414    3415    3416    3417    3418    3419    3420    3421    3422    3423    3424    3425    3426    3427    3428    3429    3430    3431    3432    3433    3434    3435    3436    3437    3438    3439    3440    3441    3442    3443    3444    3445    3446    3447    3448    3449    3450    3451    3452    3453    3454    3455    3456    3457    3458    3459    3460    3461    3462    3463    3464    3465    3466    3467    3468    3469    3470    3471    3472    3473    3474    3475    3476    3477    3478    3479    3480    3481    3482    3483    3484    3485    3486    3487    3488    3489    3490    3491    3492    3493    3494    3495    3496    3497    3498    3499    3500    3501    3502    3503    3504    3505    3506    3507    3508    3509    3510    3511    3512    3513    3514    3515    3516    3517    3518    3519    3520    3521    3522    3523    3524    3525    3526    3527    3528    3529    3530    3531    3532    3533    3534    3535    3536    3537    3538    3539    3540    3541    3542    3543    3544    3545    3546    3547    3548    3549    3550    3551    3552    3553    3554    3555    3556    3557    3558    3559    3560    3561    3562    3563    3564    3565    3566    3567    3568    3569    3570    3571    3572    3573    3574    3575    3576    3577    3578    3579    3580    3581    3582    3583    3584    3585    3586    3587    3588    3589    3590    3591    3592    3593    3594    3595    3596    3597    3598    3599    3600    3601    3602    3603    3604    3605    3606    3607    3608    3609    3610    3611    3612    3613    3614    3615    3616    3617    3618    3619    3620    3621    3622    3623    3624    3625    3626    3627    3628    3629    3630    3631    3632    3633    3634    3635    3636    3637    3638    3639    3640    3641    3642    3643    3644    3645    3646    3647    3648    3649    3650    3651    3652    3653    3654    3655    3656    3657    3658    3659    3660    3661    3662    3663    3664    3665    3666    3667    3668    3669    3670    3671    3672    3673    3674    3675    3676    3677    3678    3679    3680    3681    3682    3683    3684    3685    3686    3687    3688    3689    3690    3691    3692    3693    3694    3695    3696    3697    3698    3699    3700    3701    3702    3703    3704    3705    3706    3707    3708    3709    3710    3711    3712    3713    3714    3715    3716    3717    3718    3719    3720    3721    3722    3723    3724    3725    3726    3727    3728    3729    3730    3731    3732    3733    3734    3735    3736    3737    3738    3739    3740    3741    3742    3743    3744    3745    3746    3747    3748    3749    3750    3751    3752    3753    3754    3755    3756    3757    3758    3759    3760    3761    3762    3763    3764    3765    3766    3767    3768    3769    3770    3771    3772    3773    3774    3775    3776    3777    3778    3779    3780    3781    3782    3783    3784    3785    3786    3787    3788    3789    3790    3791    3792    3793    3794    3795    3796    3797    3798    3799    3800    3801    3802    3803    3804    3805    3806    3807    3808    3809    3810    3811    3812    3813    3814    3815    3816    3817    3818    3819    3820    3821    3822    3823    3824    3825    3826    3827    3828    3829    3830    3831    3832    3833    3834    3835    3836    3837    3838    3839    3840    3841    3842    3843    3844    3845    3846    3847    3848    3849    3850    3851    3852    3853    3854    3855    3856    3857    3858    3859    3860    3861    3862    3863    3864    3865    3866    3867    3868    3869    3870    3871    3872    3873    3874    3875    3876    3877    3878    3879    3880    3881    3882    3883    3884    3885    3886    3887    3888    3889    3890    3891    3892    3893    3894    3895    3896    3897    3898    3899    3900    3901    3902    3903    3904    3905    3906    3907    3908    3909    3910    3911    3912    3913    3914    3915    3916    3917    3918    3919    3920    3921    3922    3923    3924    3925    3926    3927    3928    3929    3930    3931    3932    3933    3934    3935    3936    3937    3938    3939    3940    3941    3942    3943    3944    3945    3946    3947    3948    3949    3950    3951    3952    3953    3954    3955    3956    3957    3958    3959    3960    3961    3962    3963    3964    3965    3966    3967    3968    3969    3970    3971    3972    3973    3974    3975    3976    3977    3978    3979    3980    3981    3982    3983    3984    3985    3986    3987    3988    3989    3990    3991    3992    3993    3994    3995    3996    3997    3998    3999    4000    4001    4002    4003    4004    4005    4006    4007    4008    4009    4010    4011    4012    4013    4014    4015    4016    4017    4018    4019    4020    4021    4022    4023    4024    4025    4026    4027    4028    4029    4030    4031    4032    4033    4034    4035    4036    4037    4038    4039    4040    4041    4042    4043    4044    4045    4046    4047    4048    4049    4050    4051    4052    4053    4054    4055    4056    4057    4058    4059    4060    4061    4062    4063    4064    4065    4066    4067    4068    4069    4070    4071    4072    4073    4074    4075    4076    4077    4078    4079    4080    4081    4082    4083    4084    4085    4086    4087    4088    4089    4090    4091    4092    4093    4094    4095    4096    4097    4098    4099    4100    4101    4102    4103    4104    4105    4106    4107    4108    4109    4110    4111    4112    4113    4114    4115    4116    4117    4118    4119    4120    4121    4122    4123    4124    4125    4126    4127    4128    4129    4130    4131    4132    4133    4134    4135    4136    4137    4138    4139    4140    4141    4142    4143    4144    4145    4146    4147    4148    4149    4150    4151    4152    4153    4154    4155    4156    4157    4158    4159    4160    4161    4162    4163    4164    4165    4166    4167    4168    4169    4170    4171    4172    4173    4174    4175    4176    4177    4178    4179    4180    4181    4182    4183    4184    4185    4186    4187    4188    4189    4190    4191    4192    4193    4194    4195    4196    4197    4198    4199    4200    4201    4202    4203    4204    4205    4206    4207    4208    4209    4210    4211    4212    4213    4214    4215    4216    4217    4218    4219    4220    4221    4222    4223    4224    4225    4226    4227    4228    4229    4230    4231    4232    4233    4234    4235    4236    4237    4238    4239    4240    4241    4242    4243    4244    4245    4246    4247    4248    4249    4250    4251    4252    4253    4254    4255    4256    4257    4258    4259    4260    4261    4262    4263    4264    4265    4266    4267    4268    4269    4270    4271    4272    4273    4274    4275    4276    4277    4278    4279    4280    4281    4282    4283    4284    4285    4286    4287    4288    4289    4290    4291    4292    4293    4294    4295    4296    4297    4298    4299    4300    4301    4302    4303    4304    4305    4306    4307    4308    4309    4310    4311    4312    4313    4314    4315    4316    4317    4318    4319    4320    4321    4322    4323    4324    4325    4326    4327    4328    4329    4330    4331    4332    4333    4334    4335    4336    4337    4338    4339    4340    4341    4342    4343    4344    4345    4346    4347    4348    4349    4350    4351    4352    4353    4354    4355    4356    4357    4358    4359    4360    4361    4362    4363    4364    4365    4366    4367    4368    4369    4370    4371    4372    4373    4374    4375    4376    4377    4378    4379    4380    4381    4382    4383    4384    4385    4386    4387    4388    4389    4390    4391    4392    4393    4394    4395    4396    4397    4398    4399    4400    4401    4402    4403    4404    4405    4406    4407    4408    4409    4410    4411    4412    4413    4414    4415    4416    4417    4418    4419    4420    4421    4422    4423    4424    4425    4426    4427    4428    4429    4430    4431    4432    4433    4434    4435    4436    4437    4438    4439    4440    4441    4442    4443    4444    4445    4446    4447    4448    4449    4450    4451    4452    4453    4454    4455    4456    4457    4458    4459    4460    4461    4462    4463    4464    4465    4466    4467    4468    4469    4470    4471    4472    4473    4474    4475    4476    4477    4478    4479    4480    4481    4482    4483    4484    4485    4486    4487    4488    4489    4490    4491    4492    4493    4494    4495    4496    4497    4498    4499    4500    4501    4502    4503    4504    4505    4506    4507    4508    4509    4510    4511    4512    4513    4514    4515    4516    4517    4518    4519    4520    4521    4522    4523    4524    4525    4526    4527    4528    4529    4530    4531    4532    4533    4534    4535    4536    4537    4538    4539    4540    4541    4542    4543    4544    4545    4546    4547    4548    4549    4550    4551    4552    4553    4554    4555    4556    4557    4558    4559    4560    4561    4562    4563    4564    4565    4566    4567    4568    4569    4570    4571    4572    4573    4574    4575    4576    4577    4578    4579    4580    4581    4582    4583    4584    4585    4586    4587    4588    4589    4590    4591    4592    4593    4594    4595    4596    4597    4598    4599    4600    4601    4602    4603    4604    4605    4606    4607    4608    4609    4610    4611    4612    4613    4614    4615    4616    4617    4618    4619    4620    4621    4622    4623    4624    4625    4626    4627    4628    4629    4630    4631    4632    4633    4634    4635    4636    4637    4638    4639    4640    4641    4642    4643    4644    4645    4646    4647    4648    4649    4650    4651    4652    4653    4654    4655    4656    4657    4658    4659    4660    4661    4662    4663    4664    4665    4666    4667    4668    4669    4670    4671    4672    4673    4674    4675    4676    4677    4678    4679    4680    4681    4682    4683    4684    4685    4686    4687    4688    4689    4690    4691    4692    4693    4694    4695    4696    4697    4698    4699    4700    4701    4702    4703    4704    4705    4706    4707    4708    4709    4710    4711    4712    4713    4714    4715    4716    4717    4718    4719    4720    4721    4722    4723    4724    4725    4726    4727    4728    4729    4730    4731    4732    4733    4734    4735    4736    4737    4738    4739    4740    4741    4742    4743    4744    4745    4746    4747    4748    4749    4750    4751    4752    4753    4754    4755    4756    4757    4758    4759    4760    4761    4762    4763    4764    4765    4766    4767    4768    4769    4770    4771    4772    4773    4774    4775    4776    4777    4778    4779    4780    4781    4782    4783    4784    4785    4786    4787    4788    4789    4790    4791    4792    4793    4794    4795    4796    4797    4798    4799    4800    4801    4802    4803    4804    4805    4806    4807    4808    4809    4810    4811    4812    4813    4814    4815    4816    4817    4818    4819    4820    4821    4822    4823    4824    4825    4826    4827    4828    4829    4830    4831    4832    4833    4834    4835    4836    4837    4838    4839    4840    4841    4842    4843    4844    4845    4846    4847    4848    4849    4850    4851    4852    4853    4854    4855    4856    4857    4858    4859    4860    4861    4862    4863    4864    4865    4866    4867    4868    4869    4870    4871    4872    4873    4874    4875    4876    4877    4878    4879    4880    4881    4882    4883    4884    4885    4886    4887    4888    4889    4890    4891    4892    4893    4894    4895    4896    4897    4898    4899    4900    4901    4902    4903    4904    4905    4906    4907    4908    4909    4910    4911    4912    4913    4914    4915    4916    4917    4918    4919    4920    4921    4922    4923    4924    4925    4926    4927    4928    4929    4930    4931    4932    4933    4934    4935    4936    4937    4938    4939    4940    4941    4942    4943    4944    4945    4946    4947    4948    4949    4950    4951    4952    4953    4954    4955    4956    4957    4958    4959    4960    4961    4962    4963    4964    4965    4966    4967    4968    4969    4970    4971    4972    4973    4974    4975    4976    4977    4978    4979    4980    4981    4982    4983    4984    4985    4986    4987    4988    4989    4990    4991    4992    4993    4994    4995    4996    4997    4998    4999    5000    5001    5002    5003    5004    5005    5006    5007    5008    5009    5010    5011    5012    5013    5014    5015    5016    5017    5018    5019    5020    5021    5022    5023    5024    5025    5026    5027    5028    5029    5030    5031    5032    5033    5034    5035    5036    5037    5038    5039    5040    5041    5042    5043    5044    5045    5046    5047    5048    5049    5050    5051    5052    5053    5054    5055    5056    5057    5058    5059    5060    5061    5062    5063    5064    5065    5066    5067    5068    5069    5070    5071    5072    5073    5074    5075    5076    5077    5078    5079    5080    5081    5082    5083    5084    5085    5086    5087    5088    5089    5090    5091    5092    5093    5094    5095    5096    5097    5098    5099    5100    5101    5102    5103    5104    5105    5106    5107    5108    5109    5110    5111    5112    5113    5114    5115    5116    5117    5118    5119    5120    5121    5122    5123    5124    5125    5126    5127    5128    5129    5130    5131    5132    5133    5134    5135    5136    5137    5138    5139    5140    5141    5142    5143    5144    5145    5146    5147    5148    5149    5150    5151    5152    5153    5154    5155    5156    5157    5158    5159    5160    5161    5162    5163    5164    5165    5166    5167    5168    5169    5170    5171    5172    5173    5174    5175    5176    5177    5178    5179    5180    5181    5182    5183    5184    5185    5186    5187    5188    5189    5190    5191    5192    5193    5194    5195    5196    5197    5198    5199    5200    5201    5202    5203    5204    5205    5206    5207    5208    5209    5210    5211    5212    5213    5214    5215    5216    5217    5218    5219    5220    5221    5222    5223    5224    5225    5226    5227    5228    5229    5230    5231    5232    5233    5234    5235    5236    5237    5238    5239    5240    5241    5242    5243    5244    5245    5246    5247    5248    5249    5250    5251    5252    5253    5254    5255    5256    5257    5258    5259    5260    5261    5262    5263    5264    5265    5266    5267    5268    5269    5270    5271    5272    5273    5274    5275    5276    5277    5278    5279    5280    5281    5282    5283    5284    5285    5286    5287    5288    5289    5290    5291    5292    5293    5294    5295    5296    5297    5298    5299    5300    5301    5302    5303    5304    5305    5306    5307    5308    5309    5310    5311    5312    5313    5314    5315    5316    5317    5318    5319    5320    5321    5322    5323    5324    5325    5326    5327    5328    5329    5330    5331    5332    5333    5334    5335    5336    5337    5338    5339    5340    5341    5342    5343    5344    5345    5346    5347    5348    5349    5350    5351    5352    5353    5354    5355    5356    5357    5358    5359    5360    5361    5362    5363    5364    5365    5366    5367    5368    5369    5370    5371    5372    5373    5374    5375    5376    5377    5378    5379    5380    5381    5382    5383    5384    5385    5386    5387    5388    5389    5390    5391    5392    5393    5394    5395    5396    5397    5398    5399    5400    5401    5402    5403    5404    5405    5406    5407    5408    5409    5410    5411    5412    5413    5414    5415    5416    5417    5418    5419    5420    5421    5422    5423    5424    5425    5426    5427    5428    5429    5430    5431    5432    5433    5434    5435    5436    5437    5438    5439    5440    5441    5442    5443    5444    5445    5446    5447    5448    5449    5450    5451    5452    5453    5454    5455    5456    5457    5458    5459    5460    5461    5462    5463    5464    5465    5466    5467    5468    5469    5470    5471    5472    5473    5474    5475    5476    5477    5478    5479    5480    5481    5482    5483    5484    5485    5486    5487    5488    5489    5490    5491    5492    5493    5494    5495    5496    5497    5498    5499    5500    5501    5502    5503    5504    5505    5506    5507    5508    5509    5510    5511    5512    5513    5514    5515    5516    5517    5518    5519    5520    5521    5522    5523    5524    5525    5526    5527    5528    5529    5530    5531    5532    5533    5534    5535    5536    5537    5538    5539    5540    5541    5542    5543    5544    5545    5546    5547    5548    5549    5550    5551    5552    5553    5554    5555    5556    5557    5558    5559    5560    5561    5562    5563    5564    5565    5566    5567    5568    5569    5570    5571    5572    5573    5574    5575    5576    5577    5578    5579    5580    5581    5582    5583    5584    5585    5586    5587    5588    5589    5590    5591    5592    5593    5594    5595    5596    5597    5598    5599    5600    5601    5602    5603    5604    5605    5606    5607    5608    5609    5610    5611    5612    5613    5614    5615    5616    5617    5618    5619    5620    5621    5622    5623    5624    5625    5626    5627    5628    5629    5630    5631    5632    5633    5634    5635    5636    5637    5638    5639    5640    5641    5642    5643    5644    5645    5646    5647    5648    5649    5650    5651    5652    5653    5654    5655    5656    5657    5658    5659    5660    5661    5662    5663    5664    5665    5666    5667    5668    5669    5670    5671    5672    5673    5674    5675    5676    5677    5678    5679    5680    5681    5682    5683    5684    5685    5686    5687    5688    5689    5690    5691    5692    5693    5694    5695    5696    5697    5698    5699    5700    5701    5702    5703    5704    5705    5706    5707    5708    5709    5710    5711    5712    5713    5714    5715    5716    5717    5718    5719    5720    5721    5722    5723    5724    5725    5726    5727    5728    5729    5730    5731    5732    5733    5734    5735    5736    5737    5738    5739    5740    5741    5742    5743    5744    5745    5746    5747    5748    5749    5750    5751    5752    5753    5754    5755    5756    5757    5758    5759    5760    5761    5762    5763    5764    5765    5766    5767    5768    5769    5770    5771    5772    5773    5774    5775    5776    5777    5778    5779    5780    5781    5782    5783    5784    5785    5786    5787    5788    5789    5790    5791    5792    5793    5794    5795    5796    5797    5798    5799    5800    5801    5802    5803    5804    5805    5806    5807    5808    5809    5810    5811    5812    5813    5814    5815    5816    5817    5818    5819    5820    5821    5822    5823    5824    5825    5826    5827    5828    5829    5830    5831    5832    5833    5834    5835    5836    5837    5838    5839    5840    5841    5842    5843    5844    5845    5846    5847    5848    5849    5850    5851    5852    5853    5854    5855    5856    5857    5858    5859    5860    5861    5862    5863    5864    5865    5866    5867    5868    5869    5870    5871    5872    5873    5874    5875    5876    5877    5878    5879    5880    5881    5882    5883    5884    5885    5886    5887    5888    5889    5890    5891    5892    5893    5894    5895    5896    5897    5898    5899    5900    5901    5902    5903    5904    5905    5906    5907    5908    5909    5910    5911    5912    5913    5914    5915    5916    5917    5918    5919    5920    5921    5922    5923    5924    5925    5926    5927    5928    5929    5930    5931    5932    5933    5934    5935    5936    5937    5938    5939    5940    5941    5942    5943    5944    5945    5946    5947    5948    5949    5950    5951    5952    5953    5954    5955    5956    5957    5958    5959    5960    5961    5962    5963    5964    5965    5966    5967    5968    5969    5970    5971    5972    5973    5974    5975    5976    5977    5978    5979    5980    5981    5982    5983    5984    5985    5986    5987    5988    5989    5990    5991    5992    5993    5994    5995    5996    5997    5998    5999    6000    6001    6002    6003    6004    6005    6006    6007    6008    6009    6010    6011    6012    6013    6014    6015    6016    6017    6018    6019    6020    6021    6022    6023    6024    6025    6026    6027    6028    6029    6030    6031    6032    6033    6034    6035    6036    6037    6038    6039    6040    6041    6042    6043    6044    6045    6046    6047    6048    6049    6050    6051    6052    6053    6054    6055    6056    6057    6058    6059    6060    6061    6062    6063    6064    6065    6066    6067    6068    6069    6070    6071    6072    6073    6074    6075    6076    6077    6078    6079    6080    6081    6082    6083    6084    6085    6086    6087    6088    6089    6090    6091    6092    6093    6094    6095    6096    6097    6098    6099    6100    6101    6102    6103    6104    6105    6106    6107    6108    6109    6110    6111    6112    6113    6114    6115    6116    6117    6118    6119    6120    6121    6122    6123    6124    6125    6126    6127    6128    6129    6130    6131    6132    6133    6134    6135    6136    6137    6138    6139    6140    6141    6142    6143    6144    6145    6146    6147    6148    6149    6150    6151    6152    6153    6154    6155    6156    6157    6158    6159    6160    6161    6162    6163    6164    6165    6166    6167    6168    6169    6170    6171    6172    6173    6174    6175    6176    6177    6178    6179    6180    6181    6182    6183    6184    6185    6186    6187    6188    6189    6190    6191    6192    6193    6194    6195    6196    6197    6198    6199    6200    6201    6202    6203    6204    6205    6206    6207    6208    6209    6210    6211    6212    6213    6214    6215    6216    6217    6218    6219    6220    6221    6222    6223    6224    6225    6226    6227    6228    6229    6230    6231    6232    6233    6234    6235    6236    6237    6238    6239    6240    6241    6242    6243    6244    6245    6246    6247    6248    6249    6250    6251    6252    6253    6254    6255    6256    6257    6258    6259    6260    6261    6262    6263    6264    6265    6266    6267    6268    6269    6270    6271    6272    6273    6274    6275    6276    6277    6278    6279    6280    6281    6282    6283    6284    6285    6286    6287    6288    6289    6290    6291    6292    6293    6294    6295    6296    6297    6298    6299    6300    6301    6302    6303    6304    6305    6306    6307    6308    6309    6310    6311    6312    6313    6314    6315    6316    6317    6318    6319    6320    6321    6322    6323    6324    6325    6326    6327    6328    6329    6330    6331    6332    6333    6334    6335    6336    6337    6338    6339    6340    6341    6342    6343    6344    6345    6346    6347    6348    6349    6350    6351    6352    6353    6354    6355    6356    6357    6358    6359    6360    6361    6362    6363    6364    6365    6366    6367    6368    6369    6370    6371    6372    6373    6374    6375    6376    6377    6378    6379    6380    6381    6382    6383    6384    6385    6386    6387    6388    6389    6390    6391    6392    6393    6394    6395    6396    6397    6398    6399    6400    6401    6402    6403    6404    6405    6406    6407    6408    6409    6410    6411    6412    6413    6414    6415    6416    6417    6418    6419    6420    6421    6422    6423    6424    6425    6426    6427    6428    6429    6430    6431    6432    6433    6434    6435    6436    6437    6438    6439    6440    6441    6442    6443    6444    6445    6446    6447    6448    6449    6450    6451    6452    6453    6454    6455    6456    6457    6458    6459    6460    6461    6462    6463    6464    6465    6466    6467    6468    6469    6470    6471    6472    6473    6474    6475    6476    6477    6478    6479    6480    6481    6482    6483    6484    6485    6486    6487    6488    6489    6490    6491    6492    6493    6494    6495    6496    6497    6498    6499    6500    6501    6502    6503    6504    6505    6506    6507    6508    6509    6510    6511    6512    6513    6514    6515    6516    6517    6518    6519    6520    6521    6522    6523    6524    6525    6526    6527    6528    6529    6530    6531    6532    6533    6534    6535    6536    6537    6538    6539    6540    6541    6542    6543    6544    6545    6546    6547    6548    6549    6550    6551    6552    6553    6554    6555    6556    6557    6558    6559    6560    6561    6562    6563    6564    6565    6566    6567    6568    6569    6570    6571    6572    6573    6574    6575    6576    6577    6578    6579    6580    6581    6582    6583    6584    6585    6586    6587    6588    6589    6590    6591    6592    6593    6594    6595    6596    6597    6598    6599    6600    6601    6602    6603    6604    6605    6606    6607    6608    6609    6610    6611    6612    6613    6614    6615    6616    6617    6618    6619    6620    6621    6622    6623    6624    6625    6626    6627    6628    6629    6630    6631    6632    6633    6634    6635    6636    6637    6638    6639    6640    6641    6642    6643    6644  

1. ?.
2. - ?.
, , , ,

? !
. MyMed ewoman    -